I’ve gone over how to make mutations of a plasmid before (since that’s the simplest molecular cloning process I could think of), but there will be many times we will need to make a new construct (via 2-part Gibson) by shuttling a DNA sequence from one plasmid to another. Here’s a tutorial describing how I do that.
First, open the maps for the two relevant plasmids on Benchling. Today it will be “G871B_pcDNA3-ACE2-SunTag-His6” serving as the backbone, and “A49172_pOPINE_GFP_nanobody” serving as the insert. The goal here will be to replace the ACE2 ectodomain in G871B with the GFP nanobody encoded by the latter construct.
Next, duplicate the map for the backbone vector. Thus, find the plasmid in the plasmid under the “Projects” tab in Benchling, right click on it to open up more options, and select “Copy to…”.
Then, make a copy into whatever directory you want to keep things organized. Today, I’ll be copying it into a directory called “Cell_surface_labeling”. A very annoying thing here is that Benchling doesn’t automatically open the copy, so if you start making edits to the plasmid map you already have open on the screen, you’ll be making edits to the *original*. Thus, make sure you go to the directory you had just located, and open duplicated file (it should start with “Copy of …”). Once open, rename the file. At this point, the plasmid won’t have a unique identifier yet, so I typically just temporarily prefix the previous identifier with “X” until I’m ready to give it it’s actual identifier. To rename the file, go to the encircled “i” icon on the far right of the screen, second from the bottom icon (the graduation cap). After you enter the new name (“XG871B_pcDNA3-Nanobody[GFP-pOPINE]-SunTag-His6” in this case), make sure you hit “Update Information” or else it will not save. Hurrah, you’ve successfully made your starting campus for in-silico designing your future construct.
Cool, now to the plasmid map with your insert, select the part you want, and do “command C” to copy it.
Now select the part of the DNA you want to replace. For this construct, we’re replacing the ACE2 ectodomain, but we want this nanobody to be secreted, so we need to keep the signal peptide. I didn’t already have the signal peptide annotated, so I’m going to have to do it now. When in doubt, one of the easiest things to do is to consult Uniprot, which usually has things like the signal peptide already annotated. Apparently it’s the first 17 amino acids, which *should* correspond to “MSSSSWLLLSLVAVTAA”. For whatever reason, the first 17 amino acids of the existing ACE2 sequence is “MSSSSWLLLSLVAVTTA”, so there’s a A>T mutation. It’s probably not a big deal, so I’ll leave it as it is. That said, to make my construct, I now want to select the sequence I want to replace, like so:
As long as you still have the nanobody sequence copied, you can now “Command V” paste it in place of this selection. The end result should look like so:
Great, so now I have the nanobody behind the ACE2 signal peptide, but before the GCN4 peptide repeats that are part of the Sun-tag. Everything looks like it’s still in frame, so no obvious screw-ups. Now time to plan the primers. I generally start by designing the primers to amplify the insert, shooting for enough nts to give me a Tm of slightly under 60*C. I also generally put in the ~ 17nt of homology appended onto these primers, thus. The fwd primer would look like this.
Same thing for the reverse primer, and it would look like this (make sure to take the reverse complement).
To recap, the fwd primer seq should be “ttgctgtTactactgctgttcaactggtggaaagcggc” and the reverse should be “ccgttggatccggtaccagagctcaccgtcacctgagt. Cool. Next, we need to come up with the primers for amplifying the vector. It could be worth checking to see if we have any existing primers that sit in the *perfect* spot, but for most construct, that’s likely not the case. Thus, design forward and reverse primers that overlap the homology segments, and have Tm’s slightly under 60*C. The forward primer will look like this:
And the reverse primer like this:
Hmmm. I just realized the Kozak sequence isn’t a consensus one. I should probably fix that at some point. But, that’s beyond the scope of this post. So again, to recap, the fwd and rev primers for the vector are “ggtaccggatccaacggtcc” and “agcagtagtAacagcaacaaggctg”. But now you’re ready to order the oligos, so go ahead and do this. As a pro-tip, I like to organize my primer order work-areas like this:
Why? Well, the left part can be copy-pasted into the “MatreyekLab_Primer_Inventory” google sheet, while the middle section can be copy-pasted into the template for ordering primers from ThermoFisher. The right part can be copy-pasted into the “MatreyekLab_Hifi_Reactions” google sheet in anticipation of setting up the physical reaction tubes once the primers come in.