Someone recently asked what primers I use to amplify from the landing pad for sequencing. This will require me looking back at our published papers. Rather than just do this one-off and answer the email just to have to repeat this exercise in the future, I figured I’d write a blog post that I can just point people to in the future.
Why is primer design important here? The main thing is, you presumably want to avoid amplifying your unintegrated plasmid, since counts of those sequences will be completely unrelated to the genotype-phenotype relationship you’re presumably trying to measure (since only the singular integrated plasmid that expresses and is resulting in the phenotype is what matters and should be the only thing being sequenced). We normally do this by designing a PCR amplicon across an attR or attL recombination junction. Here’s an example amplicon schematic from Nisha’s Methods Mol Biology manuscript.
Amplifying across the attR junction (the near side):
This is relevant if you’re trying to do direct sequencing of our transgene of interest (much like Nisha is doing above), or if you have a barcode in the 3’UTR of your transgene of interest (or, well, the 5′ UTR, but that’s pretty uncommon). If the ampicon size becomes larger than the limit for Illumina sequencing, then you may have to do a pair of nested PCRs. In this case, the first PCR is performed with a primer recognizing the Tet-inducible promoter in the landing pad (like KAM499). The amplicon, only of recombined DNA, is then used as the second-round template for amplifying and subsequently sequencing the barcode. Here’s a screenshot of Fig 4 from the original 2017 NAR paper.
The primer we normally use to bind the Tet-inducible promoter for amplifying across the attR junction is KAM499: GAGAACGTATGTCGAGGTAGGC. If doing direct Illumina amplicon amplification (much like Nisha did, since her amplicon is sufficiently small), then the primer will presumably look something like KAM3748, which hybridizes in a pretty similar location (GCCTGGAGCAATTCCACAACAC) and has the full sequence of (AATGATACGGCGACCACCGAGATCTACACCGTGGACGGCGCCTGGAGCAATTCCACAACAC). We probably moved the binding site in KAM3748 to be closer to the attR junction just to make the amplicon ~75 nucleotides smaller than using KAM499, but no big deal either way (and especially when doing the nested approach).
Amplifying across the attL junction (the far side):
While the concept of amplifying across the attR junction is universally applicable, the details are not as the amplicon size will vastly change depending on the size of the transgene of interest. Furthermore, as mentioned above, the barcode typically ends up in the 3′ UTR, which is not a terrible place but certainly capable of having some unintended consequences like messing with the RNA steady-state abundance and translation rates. Thus, pretty early on, we switched over to barcoding to the left of the attB site in the recombination plasmid, with the idea that it is in close proximity to the transgene of interest in the plasmid itself, but allows you to amplify the attL junction in recombined genomic DNA, which ends up being far more universal between experiments. Here’s a screenshot demonstrating this in Fig 1 from our 2024 PLoS Pathogens paper, where we use it to identify samples within a library of barcoded ACE2 variants.
What primers do we use here for these amplifications?
The reverse primer tends to be something like the primer binding / hybridizing sequence in KAM4362 (ATGTGCTGCAAGGCGATTAA). In actuality, since this strategy allows you to forgo the nested PCR amplification, KAM4362 and other related ones tend to have an index (allowing for multiplexed custom Illumina sequencing) and the p5 adapter, with a full sequence like this: AATGATACGGCGACCACCGAGATCTACACCCTCGCAATTatgtgctgcaaggcgattaa
So that’s a primer that’s likely already in your attB plasmid (although you should certainly check). How about amplifying from the landing pad itself? Well, this will change a bit depending on the landing pad, since we typically use a sequence present in the most 5′ transgene encoded by the landing pad prior to recombination, such as mTagBFP2 in the original 293T AAVS1 Clone4s and the popular LLP-iCasp9-Blast Clone 12s, or Bxb1 integrase in the G542A Clone3s we typically use in the lab. For binding to mTagBFP2 we typically hybridize with this sequence (CTCGACCACCTTGATTCTCATGG) for a full primer sequence like KAM2162 (CAAGCAGAAGACGGCATACGAGATGGATCACGTctcgaccaccttgattctcatgg). For binding Bxb1 integrase, we typically hybridize with this sequence (GGCCTCCTCTTTCTGTCGAA) for a full primer sequence like KAM4364 (CAAGCAGAAGACGGCATACGAGATAGATTGCGAGggcctcctctttctgtcgaa).